ID: 1070676373

View in Genome Browser
Species Human (GRCh38)
Location 10:78414456-78414478
Sequence GTTCAACACCACCACAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070676373_1070676378 18 Left 1070676373 10:78414456-78414478 CCCTTCTTGTGGTGGTGTTGAAC No data
Right 1070676378 10:78414497-78414519 ATTTCCTTACGCTAAGTGTTAGG No data
1070676373_1070676380 26 Left 1070676373 10:78414456-78414478 CCCTTCTTGTGGTGGTGTTGAAC No data
Right 1070676380 10:78414505-78414527 ACGCTAAGTGTTAGGTCCAAAGG No data
1070676373_1070676375 -6 Left 1070676373 10:78414456-78414478 CCCTTCTTGTGGTGGTGTTGAAC No data
Right 1070676375 10:78414473-78414495 TTGAACTCTTTCCTCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070676373 Original CRISPR GTTCAACACCACCACAAGAA GGG (reversed) Intergenic
No off target data available for this crispr