ID: 1070676520

View in Genome Browser
Species Human (GRCh38)
Location 10:78415499-78415521
Sequence AAGAGGACCCTCTGCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070676516_1070676520 3 Left 1070676516 10:78415473-78415495 CCAGAACAGAGGCCAGACTGAAA No data
Right 1070676520 10:78415499-78415521 AAGAGGACCCTCTGCAGAGGAGG No data
1070676518_1070676520 -9 Left 1070676518 10:78415485-78415507 CCAGACTGAAATGCAAGAGGACC No data
Right 1070676520 10:78415499-78415521 AAGAGGACCCTCTGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070676520 Original CRISPR AAGAGGACCCTCTGCAGAGG AGG Intergenic
No off target data available for this crispr