ID: 1070676826

View in Genome Browser
Species Human (GRCh38)
Location 10:78417674-78417696
Sequence GACAAGGACTTGCCACCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070676826_1070676837 21 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676837 10:78417718-78417740 CCAGTGGTCACTGGGCAGGGAGG No data
1070676826_1070676835 18 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676835 10:78417715-78417737 AGTCCAGTGGTCACTGGGCAGGG No data
1070676826_1070676832 12 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676832 10:78417709-78417731 TAGCTGAGTCCAGTGGTCACTGG No data
1070676826_1070676834 17 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676834 10:78417714-78417736 GAGTCCAGTGGTCACTGGGCAGG No data
1070676826_1070676831 5 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676831 10:78417702-78417724 GATGTGTTAGCTGAGTCCAGTGG No data
1070676826_1070676833 13 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676833 10:78417710-78417732 AGCTGAGTCCAGTGGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070676826 Original CRISPR GACAAGGACTTGCCACCACT GGG (reversed) Intergenic
No off target data available for this crispr