ID: 1070676833

View in Genome Browser
Species Human (GRCh38)
Location 10:78417710-78417732
Sequence AGCTGAGTCCAGTGGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070676830_1070676833 -3 Left 1070676830 10:78417690-78417712 CCTTGTCGGCAGGATGTGTTAGC No data
Right 1070676833 10:78417710-78417732 AGCTGAGTCCAGTGGTCACTGGG No data
1070676825_1070676833 14 Left 1070676825 10:78417673-78417695 CCCCAGTGGTGGCAAGTCCTTGT No data
Right 1070676833 10:78417710-78417732 AGCTGAGTCCAGTGGTCACTGGG No data
1070676826_1070676833 13 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676833 10:78417710-78417732 AGCTGAGTCCAGTGGTCACTGGG No data
1070676827_1070676833 12 Left 1070676827 10:78417675-78417697 CCAGTGGTGGCAAGTCCTTGTCG No data
Right 1070676833 10:78417710-78417732 AGCTGAGTCCAGTGGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070676833 Original CRISPR AGCTGAGTCCAGTGGTCACT GGG Intergenic
No off target data available for this crispr