ID: 1070676834

View in Genome Browser
Species Human (GRCh38)
Location 10:78417714-78417736
Sequence GAGTCCAGTGGTCACTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070676827_1070676834 16 Left 1070676827 10:78417675-78417697 CCAGTGGTGGCAAGTCCTTGTCG No data
Right 1070676834 10:78417714-78417736 GAGTCCAGTGGTCACTGGGCAGG No data
1070676826_1070676834 17 Left 1070676826 10:78417674-78417696 CCCAGTGGTGGCAAGTCCTTGTC No data
Right 1070676834 10:78417714-78417736 GAGTCCAGTGGTCACTGGGCAGG No data
1070676830_1070676834 1 Left 1070676830 10:78417690-78417712 CCTTGTCGGCAGGATGTGTTAGC No data
Right 1070676834 10:78417714-78417736 GAGTCCAGTGGTCACTGGGCAGG No data
1070676825_1070676834 18 Left 1070676825 10:78417673-78417695 CCCCAGTGGTGGCAAGTCCTTGT No data
Right 1070676834 10:78417714-78417736 GAGTCCAGTGGTCACTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070676834 Original CRISPR GAGTCCAGTGGTCACTGGGC AGG Intergenic
No off target data available for this crispr