ID: 1070680264

View in Genome Browser
Species Human (GRCh38)
Location 10:78444054-78444076
Sequence AGGAGACCGCCTGCGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070680253_1070680264 24 Left 1070680253 10:78444007-78444029 CCTGGAGATTTGTGGGAGAGCCA No data
Right 1070680264 10:78444054-78444076 AGGAGACCGCCTGCGAAGGCAGG No data
1070680252_1070680264 25 Left 1070680252 10:78444006-78444028 CCCTGGAGATTTGTGGGAGAGCC No data
Right 1070680264 10:78444054-78444076 AGGAGACCGCCTGCGAAGGCAGG No data
1070680260_1070680264 4 Left 1070680260 10:78444027-78444049 CCAGATGGGGTCAGGGCAGAGGA No data
Right 1070680264 10:78444054-78444076 AGGAGACCGCCTGCGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070680264 Original CRISPR AGGAGACCGCCTGCGAAGGC AGG Intergenic
No off target data available for this crispr