ID: 1070680873

View in Genome Browser
Species Human (GRCh38)
Location 10:78448206-78448228
Sequence GCTCACATGGGTCAGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070680861_1070680873 20 Left 1070680861 10:78448163-78448185 CCCATAGACATCAGAAAAGGTTC No data
Right 1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG No data
1070680862_1070680873 19 Left 1070680862 10:78448164-78448186 CCATAGACATCAGAAAAGGTTCG No data
Right 1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070680873 Original CRISPR GCTCACATGGGTCAGGAACC TGG Intergenic
No off target data available for this crispr