ID: 1070682412

View in Genome Browser
Species Human (GRCh38)
Location 10:78457669-78457691
Sequence AGCTATACCCCTTGGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070682408_1070682412 -3 Left 1070682408 10:78457649-78457671 CCAGGAGGAAGGAACCTGGTAGC No data
Right 1070682412 10:78457669-78457691 AGCTATACCCCTTGGATGGTAGG No data
1070682405_1070682412 10 Left 1070682405 10:78457636-78457658 CCTCTTAACAAATCCAGGAGGAA No data
Right 1070682412 10:78457669-78457691 AGCTATACCCCTTGGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070682412 Original CRISPR AGCTATACCCCTTGGATGGT AGG Intergenic
No off target data available for this crispr