ID: 1070685643

View in Genome Browser
Species Human (GRCh38)
Location 10:78478384-78478406
Sequence CCAGTCTCCCAGCCTAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070685643_1070685648 23 Left 1070685643 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG No data
Right 1070685648 10:78478430-78478452 CATGATAAGAAGTATTATTTGGG No data
1070685643_1070685647 22 Left 1070685643 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG No data
Right 1070685647 10:78478429-78478451 ACATGATAAGAAGTATTATTTGG No data
1070685643_1070685645 -10 Left 1070685643 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG No data
Right 1070685645 10:78478397-78478419 GGGAGACTGGACAGCCTTTGTGG No data
1070685643_1070685650 25 Left 1070685643 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG No data
Right 1070685650 10:78478432-78478454 TGATAAGAAGTATTATTTGGGGG No data
1070685643_1070685649 24 Left 1070685643 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG No data
Right 1070685649 10:78478431-78478453 ATGATAAGAAGTATTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070685643 Original CRISPR CCAGTCTCCCAGCCTAAGTC TGG (reversed) Intergenic
No off target data available for this crispr