ID: 1070687589

View in Genome Browser
Species Human (GRCh38)
Location 10:78500630-78500652
Sequence TCAGCCCCATTGTGTCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070687589_1070687594 25 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687594 10:78500678-78500700 TCAACATTGGTTGTTTCCTCTGG No data
1070687589_1070687595 26 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687595 10:78500679-78500701 CAACATTGGTTGTTTCCTCTGGG No data
1070687589_1070687596 27 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687596 10:78500680-78500702 AACATTGGTTGTTTCCTCTGGGG No data
1070687589_1070687593 12 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687593 10:78500665-78500687 AGATGGGTTTCATTCAACATTGG No data
1070687589_1070687591 -5 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687591 10:78500648-78500670 GCTGAACATCTCGTCATAGATGG No data
1070687589_1070687597 28 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687597 10:78500681-78500703 ACATTGGTTGTTTCCTCTGGGGG No data
1070687589_1070687599 30 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687599 10:78500683-78500705 ATTGGTTGTTTCCTCTGGGGGGG No data
1070687589_1070687592 -4 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687592 10:78500649-78500671 CTGAACATCTCGTCATAGATGGG No data
1070687589_1070687598 29 Left 1070687589 10:78500630-78500652 CCCTAATGACACAATGGGGCTGA No data
Right 1070687598 10:78500682-78500704 CATTGGTTGTTTCCTCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070687589 Original CRISPR TCAGCCCCATTGTGTCATTA GGG (reversed) Intergenic