ID: 1070688831

View in Genome Browser
Species Human (GRCh38)
Location 10:78509800-78509822
Sequence CAGGCCCCTGCACTTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070688831_1070688833 -7 Left 1070688831 10:78509800-78509822 CCAGGAGCAAGTGCAGGGGCCTG No data
Right 1070688833 10:78509816-78509838 GGGCCTGGCTTCATTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070688831 Original CRISPR CAGGCCCCTGCACTTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr