ID: 1070690151 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:78518354-78518376 |
| Sequence | CTGCTGACGGGGGTCCTGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070690143_1070690151 | -8 | Left | 1070690143 | 10:78518339-78518361 | CCAGAGATCCCAATCCTGCTGAC | No data | ||
| Right | 1070690151 | 10:78518354-78518376 | CTGCTGACGGGGGTCCTGAGTGG | No data | ||||
| 1070690142_1070690151 | -3 | Left | 1070690142 | 10:78518334-78518356 | CCTTTCCAGAGATCCCAATCCTG | No data | ||
| Right | 1070690151 | 10:78518354-78518376 | CTGCTGACGGGGGTCCTGAGTGG | No data | ||||
| 1070690141_1070690151 | 14 | Left | 1070690141 | 10:78518317-78518339 | CCGCAGGCGTCTCTGGACCTTTC | No data | ||
| Right | 1070690151 | 10:78518354-78518376 | CTGCTGACGGGGGTCCTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070690151 | Original CRISPR | CTGCTGACGGGGGTCCTGAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||