ID: 1070690151

View in Genome Browser
Species Human (GRCh38)
Location 10:78518354-78518376
Sequence CTGCTGACGGGGGTCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070690143_1070690151 -8 Left 1070690143 10:78518339-78518361 CCAGAGATCCCAATCCTGCTGAC No data
Right 1070690151 10:78518354-78518376 CTGCTGACGGGGGTCCTGAGTGG No data
1070690142_1070690151 -3 Left 1070690142 10:78518334-78518356 CCTTTCCAGAGATCCCAATCCTG No data
Right 1070690151 10:78518354-78518376 CTGCTGACGGGGGTCCTGAGTGG No data
1070690141_1070690151 14 Left 1070690141 10:78518317-78518339 CCGCAGGCGTCTCTGGACCTTTC No data
Right 1070690151 10:78518354-78518376 CTGCTGACGGGGGTCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070690151 Original CRISPR CTGCTGACGGGGGTCCTGAG TGG Intergenic
No off target data available for this crispr