ID: 1070693339

View in Genome Browser
Species Human (GRCh38)
Location 10:78543680-78543702
Sequence CTATAAGCCCAGGGGGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693332_1070693339 28 Left 1070693332 10:78543629-78543651 CCTATTTACAAAGCACTTTTATT No data
Right 1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693339 Original CRISPR CTATAAGCCCAGGGGGAACC CGG Intergenic
No off target data available for this crispr