ID: 1070693611

View in Genome Browser
Species Human (GRCh38)
Location 10:78545442-78545464
Sequence ACCTGTTATGGACTGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693611_1070693615 -9 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693615 10:78545456-78545478 ATAACAGGTGGTCCACAGGTAGG No data
1070693611_1070693620 8 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693620 10:78545473-78545495 GGTAGGCTTGAGTGGGCTAAGGG No data
1070693611_1070693617 1 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693617 10:78545466-78545488 GTCCACAGGTAGGCTTGAGTGGG No data
1070693611_1070693619 7 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693619 10:78545472-78545494 AGGTAGGCTTGAGTGGGCTAAGG No data
1070693611_1070693622 16 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693622 10:78545481-78545503 TGAGTGGGCTAAGGGTTGGCAGG No data
1070693611_1070693616 0 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693616 10:78545465-78545487 GGTCCACAGGTAGGCTTGAGTGG No data
1070693611_1070693621 12 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693621 10:78545477-78545499 GGCTTGAGTGGGCTAAGGGTTGG No data
1070693611_1070693623 26 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693611 Original CRISPR ACCTGTTATGGACTGAATGC TGG (reversed) Intergenic
No off target data available for this crispr