ID: 1070693615

View in Genome Browser
Species Human (GRCh38)
Location 10:78545456-78545478
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693611_1070693615 -9 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693615 10:78545456-78545478 ATAACAGGTGGTCCACAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693615 Original CRISPR ATAACAGGTGGTCCACAGGT AGG Intergenic
No off target data available for this crispr