ID: 1070693617

View in Genome Browser
Species Human (GRCh38)
Location 10:78545466-78545488
Sequence GTCCACAGGTAGGCTTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693611_1070693617 1 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693617 10:78545466-78545488 GTCCACAGGTAGGCTTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693617 Original CRISPR GTCCACAGGTAGGCTTGAGT GGG Intergenic
No off target data available for this crispr