ID: 1070693618

View in Genome Browser
Species Human (GRCh38)
Location 10:78545468-78545490
Sequence AGCCCACTCAAGCCTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693618_1070693622 -10 Left 1070693618 10:78545468-78545490 CCACAGGTAGGCTTGAGTGGGCT No data
Right 1070693622 10:78545481-78545503 TGAGTGGGCTAAGGGTTGGCAGG No data
1070693618_1070693624 9 Left 1070693618 10:78545468-78545490 CCACAGGTAGGCTTGAGTGGGCT No data
Right 1070693624 10:78545500-78545522 CAGGAAGCTGCTGGAATTGCAGG No data
1070693618_1070693625 10 Left 1070693618 10:78545468-78545490 CCACAGGTAGGCTTGAGTGGGCT No data
Right 1070693625 10:78545501-78545523 AGGAAGCTGCTGGAATTGCAGGG No data
1070693618_1070693623 0 Left 1070693618 10:78545468-78545490 CCACAGGTAGGCTTGAGTGGGCT No data
Right 1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693618 Original CRISPR AGCCCACTCAAGCCTACCTG TGG (reversed) Intergenic
No off target data available for this crispr