ID: 1070693619

View in Genome Browser
Species Human (GRCh38)
Location 10:78545472-78545494
Sequence AGGTAGGCTTGAGTGGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693614_1070693619 -5 Left 1070693614 10:78545454-78545476 CCATAACAGGTGGTCCACAGGTA No data
Right 1070693619 10:78545472-78545494 AGGTAGGCTTGAGTGGGCTAAGG No data
1070693611_1070693619 7 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693619 10:78545472-78545494 AGGTAGGCTTGAGTGGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693619 Original CRISPR AGGTAGGCTTGAGTGGGCTA AGG Intergenic
No off target data available for this crispr