ID: 1070693620

View in Genome Browser
Species Human (GRCh38)
Location 10:78545473-78545495
Sequence GGTAGGCTTGAGTGGGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693611_1070693620 8 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693620 10:78545473-78545495 GGTAGGCTTGAGTGGGCTAAGGG No data
1070693614_1070693620 -4 Left 1070693614 10:78545454-78545476 CCATAACAGGTGGTCCACAGGTA No data
Right 1070693620 10:78545473-78545495 GGTAGGCTTGAGTGGGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693620 Original CRISPR GGTAGGCTTGAGTGGGCTAA GGG Intergenic
No off target data available for this crispr