ID: 1070693622

View in Genome Browser
Species Human (GRCh38)
Location 10:78545481-78545503
Sequence TGAGTGGGCTAAGGGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070693618_1070693622 -10 Left 1070693618 10:78545468-78545490 CCACAGGTAGGCTTGAGTGGGCT No data
Right 1070693622 10:78545481-78545503 TGAGTGGGCTAAGGGTTGGCAGG No data
1070693614_1070693622 4 Left 1070693614 10:78545454-78545476 CCATAACAGGTGGTCCACAGGTA No data
Right 1070693622 10:78545481-78545503 TGAGTGGGCTAAGGGTTGGCAGG No data
1070693611_1070693622 16 Left 1070693611 10:78545442-78545464 CCAGCATTCAGTCCATAACAGGT No data
Right 1070693622 10:78545481-78545503 TGAGTGGGCTAAGGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070693622 Original CRISPR TGAGTGGGCTAAGGGTTGGC AGG Intergenic
No off target data available for this crispr