ID: 1070694542

View in Genome Browser
Species Human (GRCh38)
Location 10:78552208-78552230
Sequence CCTGAGCTTCACCGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070694535_1070694542 16 Left 1070694535 10:78552169-78552191 CCTTAGCATTGTCTTTTCCTGAA No data
Right 1070694542 10:78552208-78552230 CCTGAGCTTCACCGGGGAGCTGG No data
1070694534_1070694542 26 Left 1070694534 10:78552159-78552181 CCACATACTTCCTTAGCATTGTC No data
Right 1070694542 10:78552208-78552230 CCTGAGCTTCACCGGGGAGCTGG No data
1070694537_1070694542 -10 Left 1070694537 10:78552195-78552217 CCAAACACAGCAGCCTGAGCTTC No data
Right 1070694542 10:78552208-78552230 CCTGAGCTTCACCGGGGAGCTGG No data
1070694536_1070694542 -1 Left 1070694536 10:78552186-78552208 CCTGAATTACCAAACACAGCAGC No data
Right 1070694542 10:78552208-78552230 CCTGAGCTTCACCGGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070694542 Original CRISPR CCTGAGCTTCACCGGGGAGC TGG Intergenic
No off target data available for this crispr