ID: 1070695852

View in Genome Browser
Species Human (GRCh38)
Location 10:78562460-78562482
Sequence AGGACTGATGCCTCATTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070695848_1070695852 8 Left 1070695848 10:78562429-78562451 CCGACTTTTGGGGGTGGACGGCC No data
Right 1070695852 10:78562460-78562482 AGGACTGATGCCTCATTTCTAGG No data
1070695847_1070695852 9 Left 1070695847 10:78562428-78562450 CCCGACTTTTGGGGGTGGACGGC No data
Right 1070695852 10:78562460-78562482 AGGACTGATGCCTCATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070695852 Original CRISPR AGGACTGATGCCTCATTTCT AGG Intergenic
No off target data available for this crispr