ID: 1070698248

View in Genome Browser
Species Human (GRCh38)
Location 10:78579044-78579066
Sequence ACTTGTCCACAGATGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070698248_1070698249 -9 Left 1070698248 10:78579044-78579066 CCTCTCTGCATCTGTGGACAAGT No data
Right 1070698249 10:78579058-78579080 TGGACAAGTTGTTCCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070698248 Original CRISPR ACTTGTCCACAGATGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr