ID: 1070698538

View in Genome Browser
Species Human (GRCh38)
Location 10:78581595-78581617
Sequence GAGTGAGACTAGTGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070698538_1070698543 16 Left 1070698538 10:78581595-78581617 CCTTCTTCCCACTAGTCTCACTC No data
Right 1070698543 10:78581634-78581656 CATTTATGTGTCATTATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070698538 Original CRISPR GAGTGAGACTAGTGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr