ID: 1070699316

View in Genome Browser
Species Human (GRCh38)
Location 10:78588182-78588204
Sequence TTTGGAGCCCAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070699311_1070699316 -7 Left 1070699311 10:78588166-78588188 CCCAGCCTGAAGCATTTTTGGAG No data
Right 1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG No data
1070699312_1070699316 -8 Left 1070699312 10:78588167-78588189 CCAGCCTGAAGCATTTTTGGAGC No data
Right 1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070699316 Original CRISPR TTTGGAGCCCAGAGGGAGCC AGG Intergenic
No off target data available for this crispr