ID: 1070702220

View in Genome Browser
Species Human (GRCh38)
Location 10:78612499-78612521
Sequence GACACAGAGGTGGCTCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070702217_1070702220 -7 Left 1070702217 10:78612483-78612505 CCTTGAAATATGGCAGGACACAG No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data
1070702214_1070702220 1 Left 1070702214 10:78612475-78612497 CCAACTGCCCTTGAAATATGGCA No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data
1070702210_1070702220 19 Left 1070702210 10:78612457-78612479 CCTCTTCAAAGTGGGTCCCCAAC No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data
1070702216_1070702220 -6 Left 1070702216 10:78612482-78612504 CCCTTGAAATATGGCAGGACACA No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data
1070702213_1070702220 2 Left 1070702213 10:78612474-78612496 CCCAACTGCCCTTGAAATATGGC No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data
1070702211_1070702220 3 Left 1070702211 10:78612473-78612495 CCCCAACTGCCCTTGAAATATGG No data
Right 1070702220 10:78612499-78612521 GACACAGAGGTGGCTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070702220 Original CRISPR GACACAGAGGTGGCTCTGAG AGG Intergenic
No off target data available for this crispr