ID: 1070705704

View in Genome Browser
Species Human (GRCh38)
Location 10:78636457-78636479
Sequence GTTCCATAACCTATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070705704_1070705713 30 Left 1070705704 10:78636457-78636479 CCATGTTTCATAGGTTATGGAAC No data
Right 1070705713 10:78636510-78636532 AAGGTCACTTAGAGTATTCATGG No data
1070705704_1070705711 11 Left 1070705704 10:78636457-78636479 CCATGTTTCATAGGTTATGGAAC No data
Right 1070705711 10:78636491-78636513 GAGGGAAAGTTATCAGCCAAAGG No data
1070705704_1070705707 -8 Left 1070705704 10:78636457-78636479 CCATGTTTCATAGGTTATGGAAC No data
Right 1070705707 10:78636472-78636494 TATGGAACGGAGGCCCAGAGAGG No data
1070705704_1070705708 -7 Left 1070705704 10:78636457-78636479 CCATGTTTCATAGGTTATGGAAC No data
Right 1070705708 10:78636473-78636495 ATGGAACGGAGGCCCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070705704 Original CRISPR GTTCCATAACCTATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr