ID: 1070706657

View in Genome Browser
Species Human (GRCh38)
Location 10:78644095-78644117
Sequence TTGTATATGAATACTTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070706654_1070706657 -3 Left 1070706654 10:78644075-78644097 CCATCAAAACTGATGTGGTGTTG No data
Right 1070706657 10:78644095-78644117 TTGTATATGAATACTTAGGTGGG No data
1070706652_1070706657 5 Left 1070706652 10:78644067-78644089 CCATTCAGCCATCAAAACTGATG No data
Right 1070706657 10:78644095-78644117 TTGTATATGAATACTTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070706657 Original CRISPR TTGTATATGAATACTTAGGT GGG Intergenic
No off target data available for this crispr