ID: 1070707187

View in Genome Browser
Species Human (GRCh38)
Location 10:78648241-78648263
Sequence GTTAGGAACAGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070707187_1070707195 13 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707195 10:78648277-78648299 GGACAGTTGAGGAAAACATGAGG No data
1070707187_1070707192 -8 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707187_1070707196 14 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707196 10:78648278-78648300 GACAGTTGAGGAAAACATGAGGG No data
1070707187_1070707194 2 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070707187 Original CRISPR GTTAGGAACAGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr