ID: 1070707192

View in Genome Browser
Species Human (GRCh38)
Location 10:78648256-78648278
Sequence TTCCTAACTGTGGCTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070707186_1070707192 -7 Left 1070707186 10:78648240-78648262 CCCTTCCACCTTCCTGTTCCTAA No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707185_1070707192 -4 Left 1070707185 10:78648237-78648259 CCTCCCTTCCACCTTCCTGTTCC No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707187_1070707192 -8 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707179_1070707192 26 Left 1070707179 10:78648207-78648229 CCTAGGCTCTCAAAATAAGCCTT No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707184_1070707192 -3 Left 1070707184 10:78648236-78648258 CCCTCCCTTCCACCTTCCTGTTC No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data
1070707183_1070707192 7 Left 1070707183 10:78648226-78648248 CCTTGGGGCTCCCTCCCTTCCAC No data
Right 1070707192 10:78648256-78648278 TTCCTAACTGTGGCTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070707192 Original CRISPR TTCCTAACTGTGGCTAAAAC AGG Intergenic
No off target data available for this crispr