ID: 1070707194

View in Genome Browser
Species Human (GRCh38)
Location 10:78648266-78648288
Sequence TGGCTAAAACAGGACAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070707183_1070707194 17 Left 1070707183 10:78648226-78648248 CCTTGGGGCTCCCTCCCTTCCAC No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707190_1070707194 -5 Left 1070707190 10:78648248-78648270 CCTTCCTGTTCCTAACTGTGGCT No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707188_1070707194 -2 Left 1070707188 10:78648245-78648267 CCACCTTCCTGTTCCTAACTGTG No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707184_1070707194 7 Left 1070707184 10:78648236-78648258 CCCTCCCTTCCACCTTCCTGTTC No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707191_1070707194 -9 Left 1070707191 10:78648252-78648274 CCTGTTCCTAACTGTGGCTAAAA No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707186_1070707194 3 Left 1070707186 10:78648240-78648262 CCCTTCCACCTTCCTGTTCCTAA No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707185_1070707194 6 Left 1070707185 10:78648237-78648259 CCTCCCTTCCACCTTCCTGTTCC No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data
1070707187_1070707194 2 Left 1070707187 10:78648241-78648263 CCTTCCACCTTCCTGTTCCTAAC No data
Right 1070707194 10:78648266-78648288 TGGCTAAAACAGGACAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070707194 Original CRISPR TGGCTAAAACAGGACAGTTG AGG Intergenic
No off target data available for this crispr