ID: 1070711219

View in Genome Browser
Species Human (GRCh38)
Location 10:78684554-78684576
Sequence GTGGAGAGATGGCCCCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070711219_1070711224 -8 Left 1070711219 10:78684554-78684576 CCTTTAGGGGGCCATCTCTCCAC No data
Right 1070711224 10:78684569-78684591 CTCTCCACACTAGAGTTTGGGGG No data
1070711219_1070711223 -9 Left 1070711219 10:78684554-78684576 CCTTTAGGGGGCCATCTCTCCAC No data
Right 1070711223 10:78684568-78684590 TCTCTCCACACTAGAGTTTGGGG No data
1070711219_1070711226 28 Left 1070711219 10:78684554-78684576 CCTTTAGGGGGCCATCTCTCCAC No data
Right 1070711226 10:78684605-78684627 ATCAGCCTCCAGTCATCAGCCGG No data
1070711219_1070711222 -10 Left 1070711219 10:78684554-78684576 CCTTTAGGGGGCCATCTCTCCAC No data
Right 1070711222 10:78684567-78684589 ATCTCTCCACACTAGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070711219 Original CRISPR GTGGAGAGATGGCCCCCTAA AGG (reversed) Intergenic
No off target data available for this crispr