ID: 1070712569

View in Genome Browser
Species Human (GRCh38)
Location 10:78693480-78693502
Sequence GAATGAACAATGTGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070712565_1070712569 3 Left 1070712565 10:78693454-78693476 CCACATCCATCACACTCACCAAT No data
Right 1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG No data
1070712566_1070712569 -3 Left 1070712566 10:78693460-78693482 CCATCACACTCACCAATGAAGAA No data
Right 1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG No data
1070712564_1070712569 21 Left 1070712564 10:78693436-78693458 CCTATATCTGAGTCTTCTCCACA No data
Right 1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070712569 Original CRISPR GAATGAACAATGTGTCAGCA GGG Intergenic
No off target data available for this crispr