ID: 1070721386

View in Genome Browser
Species Human (GRCh38)
Location 10:78759635-78759657
Sequence CTCAATACAAAGAAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070721386_1070721392 23 Left 1070721386 10:78759635-78759657 CCAAGCTCCTTCTTTGTATTGAG No data
Right 1070721392 10:78759681-78759703 TTGCAATAATGTGATGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070721386 Original CRISPR CTCAATACAAAGAAGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr