ID: 1070721628

View in Genome Browser
Species Human (GRCh38)
Location 10:78761040-78761062
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070721628_1070721631 11 Left 1070721628 10:78761040-78761062 CCTGCTCTCAGTTGTTTGGCACC No data
Right 1070721631 10:78761074-78761096 CTCTTGTCCCATTCCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070721628 Original CRISPR GGTGCCAAACAACTGAGAGC AGG (reversed) Intergenic
No off target data available for this crispr