ID: 1070723021 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:78769702-78769724 |
| Sequence | CTGTAGCCGTAGGTGTAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070723021_1070723031 | 27 | Left | 1070723021 | 10:78769702-78769724 | CCCACCTACACCTACGGCTACAG | No data | ||
| Right | 1070723031 | 10:78769752-78769774 | CCCTGCTCAAGACTCATCCAGGG | No data | ||||
| 1070723021_1070723029 | 26 | Left | 1070723021 | 10:78769702-78769724 | CCCACCTACACCTACGGCTACAG | No data | ||
| Right | 1070723029 | 10:78769751-78769773 | CCCCTGCTCAAGACTCATCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070723021 | Original CRISPR | CTGTAGCCGTAGGTGTAGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||