ID: 1070723021

View in Genome Browser
Species Human (GRCh38)
Location 10:78769702-78769724
Sequence CTGTAGCCGTAGGTGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070723021_1070723031 27 Left 1070723021 10:78769702-78769724 CCCACCTACACCTACGGCTACAG No data
Right 1070723031 10:78769752-78769774 CCCTGCTCAAGACTCATCCAGGG No data
1070723021_1070723029 26 Left 1070723021 10:78769702-78769724 CCCACCTACACCTACGGCTACAG No data
Right 1070723029 10:78769751-78769773 CCCCTGCTCAAGACTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070723021 Original CRISPR CTGTAGCCGTAGGTGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr