ID: 1070727896

View in Genome Browser
Species Human (GRCh38)
Location 10:78804515-78804537
Sequence CACGTCTCCTGGTCCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070727885_1070727896 16 Left 1070727885 10:78804476-78804498 CCTCCCATTACAAAAGCCAAAAG No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data
1070727888_1070727896 12 Left 1070727888 10:78804480-78804502 CCATTACAAAAGCCAAAAGGCCA No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data
1070727887_1070727896 13 Left 1070727887 10:78804479-78804501 CCCATTACAAAAGCCAAAAGGCC No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data
1070727889_1070727896 0 Left 1070727889 10:78804492-78804514 CCAAAAGGCCAAATCCAGCTCCC No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data
1070727890_1070727896 -8 Left 1070727890 10:78804500-78804522 CCAAATCCAGCTCCCCACGTCTC No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data
1070727884_1070727896 20 Left 1070727884 10:78804472-78804494 CCTGCCTCCCATTACAAAAGCCA No data
Right 1070727896 10:78804515-78804537 CACGTCTCCTGGTCCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070727896 Original CRISPR CACGTCTCCTGGTCCTCCCC AGG Intergenic
No off target data available for this crispr