ID: 1070731041

View in Genome Browser
Species Human (GRCh38)
Location 10:78828429-78828451
Sequence CTCGGTCCCCAGAGGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070731033_1070731041 15 Left 1070731033 10:78828391-78828413 CCAGCAGCGGCCCACACTCTGGG No data
Right 1070731041 10:78828429-78828451 CTCGGTCCCCAGAGGGTATCTGG No data
1070731035_1070731041 5 Left 1070731035 10:78828401-78828423 CCCACACTCTGGGCAGCAGAATG No data
Right 1070731041 10:78828429-78828451 CTCGGTCCCCAGAGGGTATCTGG No data
1070731036_1070731041 4 Left 1070731036 10:78828402-78828424 CCACACTCTGGGCAGCAGAATGA No data
Right 1070731041 10:78828429-78828451 CTCGGTCCCCAGAGGGTATCTGG No data
1070731031_1070731041 22 Left 1070731031 10:78828384-78828406 CCTCAAGCCAGCAGCGGCCCACA No data
Right 1070731041 10:78828429-78828451 CTCGGTCCCCAGAGGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070731041 Original CRISPR CTCGGTCCCCAGAGGGTATC TGG Intergenic
No off target data available for this crispr