ID: 1070732122

View in Genome Browser
Species Human (GRCh38)
Location 10:78837274-78837296
Sequence GAGGGTTGACTGATGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070732122_1070732126 4 Left 1070732122 10:78837274-78837296 CCAACCTGCATCAGTCAACCCTC No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070732122 Original CRISPR GAGGGTTGACTGATGCAGGT TGG (reversed) Intergenic
No off target data available for this crispr