ID: 1070732126

View in Genome Browser
Species Human (GRCh38)
Location 10:78837301-78837323
Sequence GACCTGCAGACACTTAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070732118_1070732126 20 Left 1070732118 10:78837258-78837280 CCAAGCCCAGCCGAGGCCAACCT No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data
1070732120_1070732126 14 Left 1070732120 10:78837264-78837286 CCAGCCGAGGCCAACCTGCATCA No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data
1070732123_1070732126 0 Left 1070732123 10:78837278-78837300 CCTGCATCAGTCAACCCTCAGTC No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data
1070732121_1070732126 10 Left 1070732121 10:78837268-78837290 CCGAGGCCAACCTGCATCAGTCA No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data
1070732122_1070732126 4 Left 1070732122 10:78837274-78837296 CCAACCTGCATCAGTCAACCCTC No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data
1070732119_1070732126 15 Left 1070732119 10:78837263-78837285 CCCAGCCGAGGCCAACCTGCATC No data
Right 1070732126 10:78837301-78837323 GACCTGCAGACACTTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070732126 Original CRISPR GACCTGCAGACACTTAAATG AGG Intergenic
No off target data available for this crispr