ID: 1070736003

View in Genome Browser
Species Human (GRCh38)
Location 10:78864064-78864086
Sequence TTTGAAGCACAGACAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070735998_1070736003 3 Left 1070735998 10:78864038-78864060 CCCCTGCGGTGGAGCCTGTCCTC No data
Right 1070736003 10:78864064-78864086 TTTGAAGCACAGACAGAATCTGG No data
1070735999_1070736003 2 Left 1070735999 10:78864039-78864061 CCCTGCGGTGGAGCCTGTCCTCT No data
Right 1070736003 10:78864064-78864086 TTTGAAGCACAGACAGAATCTGG No data
1070736000_1070736003 1 Left 1070736000 10:78864040-78864062 CCTGCGGTGGAGCCTGTCCTCTG No data
Right 1070736003 10:78864064-78864086 TTTGAAGCACAGACAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070736003 Original CRISPR TTTGAAGCACAGACAGAATC TGG Intergenic
No off target data available for this crispr