ID: 1070739214

View in Genome Browser
Species Human (GRCh38)
Location 10:78891677-78891699
Sequence TTTCTAATGTCATCAACCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070739211_1070739214 6 Left 1070739211 10:78891648-78891670 CCAGCTTCAACTTGCTACTCAAC No data
Right 1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG No data
1070739208_1070739214 25 Left 1070739208 10:78891629-78891651 CCAAATGCCTCTTCATCACCCAG No data
Right 1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG No data
1070739209_1070739214 18 Left 1070739209 10:78891636-78891658 CCTCTTCATCACCCAGCTTCAAC No data
Right 1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG No data
1070739207_1070739214 26 Left 1070739207 10:78891628-78891650 CCCAAATGCCTCTTCATCACCCA No data
Right 1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG No data
1070739210_1070739214 7 Left 1070739210 10:78891647-78891669 CCCAGCTTCAACTTGCTACTCAA No data
Right 1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070739214 Original CRISPR TTTCTAATGTCATCAACCCT GGG Intergenic
No off target data available for this crispr