ID: 1070739857

View in Genome Browser
Species Human (GRCh38)
Location 10:78895667-78895689
Sequence TCTCATTTGCAGGACAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070739857_1070739866 6 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739866 10:78895696-78895718 CCCAGAGAAGGGCAGGGACTGGG No data
1070739857_1070739870 15 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739870 10:78895705-78895727 GGGCAGGGACTGGGCCAGGGAGG No data
1070739857_1070739863 0 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739863 10:78895690-78895712 ACTGAGCCCAGAGAAGGGCAGGG No data
1070739857_1070739860 -6 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739860 10:78895684-78895706 ATGAGAACTGAGCCCAGAGAAGG No data
1070739857_1070739869 12 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739869 10:78895702-78895724 GAAGGGCAGGGACTGGGCCAGGG No data
1070739857_1070739862 -1 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739862 10:78895689-78895711 AACTGAGCCCAGAGAAGGGCAGG No data
1070739857_1070739871 23 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739871 10:78895713-78895735 ACTGGGCCAGGGAGGCCCACAGG No data
1070739857_1070739868 11 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739868 10:78895701-78895723 AGAAGGGCAGGGACTGGGCCAGG No data
1070739857_1070739861 -5 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739861 10:78895685-78895707 TGAGAACTGAGCCCAGAGAAGGG No data
1070739857_1070739864 5 Left 1070739857 10:78895667-78895689 CCCTTCTTGTCCTGCAAATGAGA No data
Right 1070739864 10:78895695-78895717 GCCCAGAGAAGGGCAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070739857 Original CRISPR TCTCATTTGCAGGACAAGAA GGG (reversed) Intergenic
No off target data available for this crispr