ID: 1070740432

View in Genome Browser
Species Human (GRCh38)
Location 10:78899674-78899696
Sequence TTGCTGTGTTGTCAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070740428_1070740432 2 Left 1070740428 10:78899649-78899671 CCTTGCCAACAGAGAACCACAGA No data
Right 1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG No data
1070740429_1070740432 -3 Left 1070740429 10:78899654-78899676 CCAACAGAGAACCACAGAGATTG No data
Right 1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG No data
1070740427_1070740432 3 Left 1070740427 10:78899648-78899670 CCCTTGCCAACAGAGAACCACAG No data
Right 1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG No data
1070740426_1070740432 24 Left 1070740426 10:78899627-78899649 CCGGAAATAACTATGGCACAGCC No data
Right 1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070740432 Original CRISPR TTGCTGTGTTGTCAGTGTGG AGG Intergenic
No off target data available for this crispr