ID: 1070741388

View in Genome Browser
Species Human (GRCh38)
Location 10:78905518-78905540
Sequence GGGTGAACAAAAACACACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070741388_1070741393 4 Left 1070741388 10:78905518-78905540 CCAGTGTGTGTTTTTGTTCACCC No data
Right 1070741393 10:78905545-78905567 GTGTTTGTTTACCTCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070741388 Original CRISPR GGGTGAACAAAAACACACAC TGG (reversed) Intergenic
No off target data available for this crispr