ID: 1070741583

View in Genome Browser
Species Human (GRCh38)
Location 10:78907048-78907070
Sequence CTGTGTGGAGGGAAGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070741583_1070741590 -10 Left 1070741583 10:78907048-78907070 CCTGTCCCCTTCCCTCCACACAG No data
Right 1070741590 10:78907061-78907083 CTCCACACAGCCACCATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070741583 Original CRISPR CTGTGTGGAGGGAAGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr