ID: 1070744565

View in Genome Browser
Species Human (GRCh38)
Location 10:78925481-78925503
Sequence AGGGAGAAGGAGAAAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070744559_1070744565 12 Left 1070744559 10:78925446-78925468 CCAACAGAGAATGCTAATTTTTC No data
Right 1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG No data
1070744558_1070744565 28 Left 1070744558 10:78925430-78925452 CCTTATTGGATAAACACCAACAG No data
Right 1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070744565 Original CRISPR AGGGAGAAGGAGAAAAAGGA GGG Intergenic
No off target data available for this crispr