ID: 1070746120

View in Genome Browser
Species Human (GRCh38)
Location 10:78935011-78935033
Sequence GCCCATCAGGATCACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070746120_1070746129 23 Left 1070746120 10:78935011-78935033 CCATCCATGTGATCCTGATGGGC No data
Right 1070746129 10:78935057-78935079 AGTCAGGTTCTGCTGTGGCTCGG No data
1070746120_1070746126 0 Left 1070746120 10:78935011-78935033 CCATCCATGTGATCCTGATGGGC No data
Right 1070746126 10:78935034-78935056 TCTGGAGGTGTGGAGCATGCTGG No data
1070746120_1070746128 18 Left 1070746120 10:78935011-78935033 CCATCCATGTGATCCTGATGGGC No data
Right 1070746128 10:78935052-78935074 GCTGGAGTCAGGTTCTGCTGTGG No data
1070746120_1070746127 7 Left 1070746120 10:78935011-78935033 CCATCCATGTGATCCTGATGGGC No data
Right 1070746127 10:78935041-78935063 GTGTGGAGCATGCTGGAGTCAGG No data
1070746120_1070746125 -10 Left 1070746120 10:78935011-78935033 CCATCCATGTGATCCTGATGGGC No data
Right 1070746125 10:78935024-78935046 CCTGATGGGCTCTGGAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070746120 Original CRISPR GCCCATCAGGATCACATGGA TGG (reversed) Intergenic
No off target data available for this crispr