ID: 1070746823

View in Genome Browser
Species Human (GRCh38)
Location 10:78938767-78938789
Sequence TCCTCTCCTCCACTTTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070746823_1070746826 2 Left 1070746823 10:78938767-78938789 CCCTTACAAAGTGGAGGAGAGGA No data
Right 1070746826 10:78938792-78938814 AATTTTGTGCACTCACCAATGGG No data
1070746823_1070746825 1 Left 1070746823 10:78938767-78938789 CCCTTACAAAGTGGAGGAGAGGA No data
Right 1070746825 10:78938791-78938813 CAATTTTGTGCACTCACCAATGG No data
1070746823_1070746829 28 Left 1070746823 10:78938767-78938789 CCCTTACAAAGTGGAGGAGAGGA No data
Right 1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG No data
1070746823_1070746828 18 Left 1070746823 10:78938767-78938789 CCCTTACAAAGTGGAGGAGAGGA No data
Right 1070746828 10:78938808-78938830 CAATGGGTGACTGCAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070746823 Original CRISPR TCCTCTCCTCCACTTTGTAA GGG (reversed) Intergenic
No off target data available for this crispr