ID: 1070746829

View in Genome Browser
Species Human (GRCh38)
Location 10:78938818-78938840
Sequence CTGCAGCCCTTGGCCAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070746824_1070746829 27 Left 1070746824 10:78938768-78938790 CCTTACAAAGTGGAGGAGAGGAG No data
Right 1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG No data
1070746823_1070746829 28 Left 1070746823 10:78938767-78938789 CCCTTACAAAGTGGAGGAGAGGA No data
Right 1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070746829 Original CRISPR CTGCAGCCCTTGGCCAACAC TGG Intergenic
No off target data available for this crispr